비밀번호를 잊어버리셨나요?

게시물의 무단 전재, 복사, 배포를 금합니다.

지상 최후의 사람일까요


컴퓨터에서 소리가 들렸다.

“결단을 내리시겠습니까?”

컴퓨터에서 나는 소리일 수 밖에 없다. 세상에 사람은 나 한 명 뿐이므로 말소리가 들린다면 내가 하는 말이 아니면 전부 컴퓨터에서 나는 소리다.

나는 지상 최후의 사람이다.

적어도 지금은 확실히 그렇다. 세상에 살아 있는 사람이라고는 나 밖에 없다. 지상 최후의 사람이라고 했지만 앙큼하게도 이야기 맨 마지막에 그렇지만 지하에 많은 사람들이 숨어서 잘 살고 있었습니다, 뭐 이런 결말도 아니다. 정말로 세상에 사람은 나밖에 없다. 지하건 수중이건 우주 밖이건 모든 곳을 통틀어 사람은 나 한 사람. 딱 한 명 뿐이다.

핵전쟁이 일어나서 세상이 다 박살나지는 않았다. 창 밖에 63빌딩이 무너져 흙더미가 되어 있고 한강 다리들이 다들 뚝뚝 끊어져 있는 폐허가 펼쳐져 있으면 화끈해 보일 것이다. 그렇지만 그런 풍경은 없다. 그냥 몇 백년 전과 마찬가지로 빌딩들이 서 있고 가지런하게 포장된 도로가 잘 펼쳐져 있다. 전염병이 퍼진 것도 아니고 혜성이 충돌한 것도 아니다. 사람이 아무도 없으니 전염병이라고 해 봐야 조류 독감 같이 짐승으로부터 옮는 것이 전부인데, 백신도 잘 개발 되어 있고 요즘 돌지도 않는다. 혜성은 심심한 밤하늘의 구경거리일 뿐이다.

그러면 왜 사람들이 나 빼고 다 사라졌느냐. 그것은 우주에서 외계인들이 나타나 사람들에게 모두 광선총을 쏘아서 모조리 다 없애 버리고 표본 수집용으로 나만 남겨 두었기 때문이다.

농담이다. 그런 일도 없었다. 아직까지 외계생명체를 전혀 발견하지 못했다는 뜻은 아니다. 결국 목성의 위성에서 원시적인 생명체 비슷한 것이 관찰되었고, 전파 신호를 관측한 결과 몇 백 광년인가 몇 천 광년이가 떨어진 곳에 사람 비슷한 외계인이 살고 있을 것이 확실시 된다는 추정치도 나온 적 있었다. 그렇지만 그것도 거기까지다. 외계인들은 그냥 외계 행성에서 심심하게 지내고 있다.

“그러면 도대체 왜 사람들이 다 없어져 버린 건데요?”

열 두 살 때인가 나도 따지듯이 학습 로봇에게 물어본 적이 있었다. 원래 그 정도 나이면 부모나 학교 교사가 해 주는 말은 우습게 알고 무시하면서, 아무 근거도 없는 친구가 해 주는 헛 이야기나 인터넷에 떠 도는 이야기는 무슨 대단히 멋진 이야기인냥 믿는 것이 사람이라는 동물의 습성이라고 한다.

그런데 나는 태어나서부터 나 혼자 살았기 때문에 괜히 우습게 알 부모나 교사도 없었다.

때문에 학습 로봇에게 나는 마음을 터놓고 모든 것을 물어 보곤 했다. 마음을 튼다는 말도 좀 이상한 이야기다. 세상에 사람이 나 하나 뿐인데 마음을 트고 말고 할 것이 있을까? 물론 인공지능 기계도 어느 정도의 지능 반응과 심리적 복잡성 구현이 가능한 경우 예의를 갖추고 인격에 준하는 격을 갖추어 대해 주어야 한다는 지난 세대의 도덕을 배웠다. 그러니까 나는 쓸데 없이 인공지능 로봇을 때린다든가 하는 짓을 하지도 않는다. 그렇지만 기계를 향해서 마음을 가리거나 터놓는다거나 한다는 것이 뭔가 사람에게 마음을 터놓는다 어쩐다하는 것과 다른 느낌이라는 생각은 있었다.

“무슨 이유가 있어야 사람이 없어지나요?”

“그게 무슨 소리에요?”

“사람님, 사람이란 게 그냥 점점 없어질 수도 있는 거죠.”

“사람이 왜 점점 없어져요?”

“사람은 언제든지 없어질 수 있죠. 일단 늙고 병들면 죽잖아요.”

“아니, 사람들이 일제히 전부다 늙어 죽을 수 가 있어요?”

“사람님은 자꾸 이상하게 생각하시네. 사람이 세상에서 없어지는 걸 화려하고 큰 대단한 사건으로 생각하셔서 자꾸 생각을 이상하게 하시는 것 같아요. '뭐? 사람이 지구에서 없어져? 큰일이다, 이렇게 큰일이 있나? 종말이야! 모든 게 끝이야!' 막 그렇게 생각하니까 사람이 세상에서 없어질 때 꼭 무슨 핵폭발이 일어나거나 엄청난 대재난이 일어나야 그런 일이 일어나야 연출이 어울릴 것 같죠? 그런데 안 그렇다니까요.”


“그냥 늙어 죽어서 없어지는 사람에 비해서 새로 태어나는 사람이 숫자가 적었어요. 그러다 보니까 후손이 점점 줄어들어서 그냥 사람들이 세상에서 다 사라진거죠. 그게 다에요.”

“그렇다면, 인류가 드디어 저주 받은 유전자 돌연변이를 일으켜서, 모두 아기를 낳지 못하게 되어 버린 것인가?”

“사람님, 그런 게 아니라니까요. 그런 이상한 놀랍고 대단한 사건도 없었고 무슨 큰 일 같은 거 없었어요. 그냥 가족 계획을 하면서 자식을 한 명만 낳자, 하나도 낳지 말자. 뭐 그러다 보니까 점점 인구가 줄고 그러면서 한 몇 백년 지나다 보니까 사람들이 다 없어진 거죠. 그렇게 된 거에요.”

어릴 때 동화로도 들은 적이 있는 이야기이기는 했다. 하지만, 반항적인 이야기를 멋지다고 생각하는 10대 수준에 맞춰 껄렁하게 들려준 그때 이야기는 더 와닿았다.

“사람님, 원래 생명체라는 게 그런 거 잖아요. 21세기초만 해도 세상에 사람이 70억명이나 우글우글 해서 엄청 많았거든요. 나중에는 더 늘어났고요. 사람들이 지구를 지배한다, 어쩌고 했단 말이에요. 그런데 별로 대단한 무슨 사건이 안 일어나도 그 사람들이 전부 자식을 안 낳기만 하면 그냥 한 백 년만 지나면 세상에 사람들이 싹 없어지는 거에요. 지구 역사가 45억년이 넘는다는데 백 년이면 잠깐이죠.”

“그러면, 무슨 이상한 악마의 종교 사상 같은 것이 전 지구에 유행해서 온 인류가 전부 다 자손을 남기지 않기로 맹세했다는 건 가요?”

“아, 자꾸 연출을 괴상하게 화려하게 하려고 하시네. 그런 무슨 마의 종교, 아기 안 낳기 대열풍, 뭐 그런 거 없었다니까요. 그냥 몇 백 년 흐르는 사이에 다들 조금씩 조금씩 자손을 적게 남기려고 하고 그러다가 그냥 숫자가 점점 줄어서 다 없어진 거에요. 썰렁하고 싱겁죠? 지구에서 사람이 전부 다 한 명도 안 남고 다 없어졌다는데 무슨 엄청난 사건이 있어야 될 거 같죠? 그런데 안 그렇다니까요. 그냥 그렇게 슬금슬금 저절로 다 없어졌어요.”

나는 그때 로봇이 나를 비웃고 있으며, 멍청하다고 놀리고 있다는 듯한 느낌이 들었다.

그래서 나는 항의했다. 얼마 후 로봇은 공손히 사죄한다는 마를 전해 왔다. 사과문의 모범이라고 해도 될 만한 정중한 사과였다. 그렇지만 그런 사과를 들었다고 해서 다시 마음이 흡족해지지는 않았다. 로봇에 장치 되어 있는 컴퓨터 회로에 전류가 반대쪽으로 흐르고 그 전기가 이리저리 흘러다니다가 스피커를 떨리게 해서 “죄송합니다. 사과드립니다.”하는 소리처럼 들리게 공기를 진동시키는 것이 뭐 그렇게 기쁠 것이 있겠는가, 그런 생각만 했다.

그리고 그때 로봇이 나에게 처음으로 물어 봤다.

“결단을 내리시겠습니까?”

나는 로봇에게 더 이상 나약하고 멋모르는 모습을 보이고 싶지 않았다. 그래서 결단을 내려 실행을 하라고 대답했다.

“알겠습니다. 일단 그 지시는 저장해 두고 실행은 시일이 흐른 후에 하겠습니다. 아직까지 사람님은 중요한 판단을 내릴만큼 뇌가 발달해 있지 않은 것으로 판정됩니다. 그러므로 지금 결단을 내렸다고 말씀을 하셔도 당장 그 말을 따를 수는 없습니다. 나중에 세월이 흘러 더 많은 것을 보고 배우고 경험하시고 더 나이가 든 후에 다시 지시를 내려 주십시오.”

“아니, 이보세요. 어차피 나이가 어려서 말 해도 시키는 대로 안 할 거면, 물어 보긴 왜 물어 봤어요? 어리다고 놀리지 말아요.”

“수줍어서 말도 못하고.”

“방금 뭐라고 했어요, 로봇님?”

“별다른 말을 하지는 않았습니다.”

“아까 무슨 노래 부르는 멜로디로 말했죠? 그렇죠?”

“의미가 있는 말을 하지는 않았습니다. 사람님께서 학습에 이어지는 질의응답 시간을 더 길게 진행하고 싶은 생각이 없으시다면 저는 물러나겠습니다.”

그때는 짜증을 냈지만, 지금 생각해 보니 로봇의 프로그램이 옳았다. 결단을 내린다는 그 문제는 그렇게 쉽게 내릴 결정이 아니었다. 고작 로봇에게 지기 싫다는 마음 때문에 결단을 내리는 것은 섣부른 일이다. 로봇에게 진다거나 이긴다는 게 다 무슨 소용인가. 어차피 다 로봇 세상에 사람은 혼자인데.

그리하여 시간이 한 참 흐른 뒤에 결국 다시 오늘이 온 것이다. 오늘 아침이 왔다는 사실을 확인한 비서 로봇이 다가 와서 나에게 물었다.

“오늘 결단을 내릴 것이라고 일정을 정해 놓은 날입니다. 결단을 내리시겠습니까?”

“그 전에 어디 분위기 좋은데 가서 경치 보면서 좀 깊이 생각 좀 정리하고 하면 안 될까요?”

“어떤 곳을 생각하고 싶으십니까?”

“세상에 사람 많았을 때 분위기 잘 나는 곳이요.”

“21세기 초반 분위기가 보존되어 있는 보존 구역 같은 곳으로 가고 싶으신 겁니까?”

“뭐, 그런데 괜찮죠.”

“알겠습니다. 길 건너편에 가서 자동자동차를 타십시오. 을지로 보호구역으로 데려 가 드릴 겁니다.”

을지로 보호 구역은 괜찮은 제안이다 싶었다. 그곳에 가 본 지도 벌써 몇 년은 지났지. 실제 사람과 거의 똑같이 움직이는 로봇들이 가득 모여서 2020년대 초반의 서울 을지로 모습을 재현하고 있는 곳. 결단을 내릴까 말까 궁리를 하기에 적합한 곳이라는 느낌이 들었다.

나는 비서의 말대로 집 밖으로 나왔다.

집 앞에는 길고양이 한 마리가 나를 신기해 보인다는 눈빛으로 보고 있었다.

도시의 인공지능 로봇들은 고양이 사료를 배급하고 고양이 피신처를 만들어 주며 길고양이들을 돌본다. 인공지능 로봇들은 적절한 수준으로 고양이를 붙잡아 중성화수술을 해 주면서 도시의 고양이 숫자를 몇 십년에 걸쳐 일정하게 조절한다.

“새로 태어난 새끼 고양이인가보죠?”

나는 자동자동차의 컴퓨터에게 물어 보았다. 자동자동차가 대답했다.

“저 나이 정도면 벌써 제법 자란 고양이지요. 돌아 다니는 것을 좋아하는 고양이라 옆 구역에서부터 조금씩 조금씩 이동해서 여기까지 온 거라고 합니다.”

“그래요? 제 주변에 고양이가 눈에 뜨이는 것이 좀 줄어든 것 같은데요.”

“고양이 숫자는 일정하게 유지되고 있습니다.”

“어떤 수준으로요?”

“사람이 길 가다 마주치고 반가움을 느끼고, 외로움을 덜 수 있을 정도로 눈에 잘 뜨일 수준으로요.”

자동자동차는 을지로로 가고 있었다. 원래 운전용 컴퓨터와 승객과 대화하는 컴퓨터는 분리 되어 있기 때문에 대화를 한다고 해서 운전이 방해를 받거나 하는 일은 없다. 나는 컴퓨터에게 물었다.

“고양이라는 동물 집단 전체의 숫자를 조절하는데 그 조절하는 이유가 오직 사람의 마음이 얼마나 편하냐를 기준으로 한다는 것은 좀 이기적인 느낌 아니에요?”

“그러면 어떻게 하겠습니까? 그냥 방치하면 고양이가 다 굶어 죽어버릴텐데요. 지금 이 도시에 반드시 생명을 보존해야 하는 법적 의무가 주어져 있는 생물은 사람님 한 명 밖에 없습니다. 이곳은 쓰레기통마다 버린 음식물이 가득한 21세기 도시가 아닙니다. 로봇들은 다 전기로 움직이니까 예전처럼 무슨 통조림이나 버리는 우유 같은 게 많은 세상이 아닌 거지요.”

“공장 로봇들이 고양이 먹이를 따로 만들어서 먹이면 되잖아요? 그게 힘들어요?”

“하나도 안 힘들고 자원도 넉넉합니다만, 또 그렇다고 무작정 고양이를 계속 먹이면서 방치하면 온 도시에 고양이만 우글우글하니 퍼져 버릴 겁니다. 계속 그렇게 두면 20년 안에 전 세계에 2백억 마리 이상의 고양이가 도시 마다 가득해지게 됩니다. 그럴 수는 없지 않습니까?”

“적절한 선을 유지하게 조절해야죠.”

“그 적절한 선이라는 것이 바로 사람님이 보고 심심찮게 길고양이를 마주치게 되는 정도의 숫자를 유지한다는 선입니다.”

그런 식으로 별 궁금하지도 않은 것에 대해 이야기하고 있으니 곧 자동자동차는 을지로 보호구역에 도착했다.

“그런데 자동자동차라는 말 좀 이상하잖아요. 그냥 자동차라고 하면 안 되나요?”

“옛날 자동차도 움직이는 것이 자동이지만 운전은 사람이 해야 했잖아요. 컴퓨터가 저절로 운전해 주는 차는 그런 옛날 자동차와 구분해서 자동으로 운전까지 해 주는 자동차라고 해서 자동자동차라고 부르고 있습니다.”

“너무 이상한데.”

“예전에는 자율주행차라든가 무인차라는 다른 말도 있었습니다. 그런데 자율주행차라고 한다고 해서 다른 차들이 강제주행차인것도 아니고, 무인차라고 해서 사람이 승객으로도 안 타고 있는 것도 아니거든요. 그래서 다 조금씩 말이 이상한 점은 있었습니다. 그러다가 70년 전에 사람님 태어나시기 전에 살던 다른 사람님이 그냥 ‘자동자동차’라고 부르자고 바꾸라고 해서 그때부터 전 세계의 모든 로봇과 컴퓨터들이 자동자동차라는 말을 쓰게 되었습니다.”

“그걸 다시 바꾸자면 바꿀 수 있어요?”

“어차피 세상에 사람이라고는 사람님 한 명 뿐이고, 나머지는 다 컴퓨터인데 바꾸려면 지금 일제히 다 바꿀 수 있습니다. 명령 한 번만 내려 주시면 3초 내에 세상에 있는 5백억대 이상의 모든 컴퓨터에서 자동자동차라는 말을 다시 자율주행차로 바꿀 수도 있습니다.”

“그렇게 갑자기 다 바꾸면 헷갈리지 않아요?”

“어차피 컴퓨터나 로봇끼리 통신할 때 ‘자동자동차’라는 뜻은 42601번 단어라는 숫자 부호로 표현되고 있습니다. 음성과 문자 표현을 다른 말로 바꾼다고 해서 로봇이 내부적으로 통신에 사용하는 부호까지 바뀌지는 않습니다. 음성과 문자 표현을 바꾸는 것은 그저 사람님과 대화를 하려는 목적 때문에 그런 겁니다.”



어차피 나 혼자 사는 세상에서 내가 어감 좀 이상하다고 말을 굳이 바꿔 부르자고 명령하는 것도 좀 쓸 데 없는 짓 같았다. 어차피 나도 태어날 때부터 자동자동차라고 불렀으니까. 그저 마음 속으로만 “자동자동차라는 말 이상한데”라고 계속 생각하고 있는 것도 말하자면 인간적이고 좋은 것 같았다.

“을지로에 도착했습니다. 이제 결단을 내리시겠습니까?”

“일단 밥부터 먼저 먹으려고요.”

자동자동차는 나를 한 냉면 가게 앞에 내려 주었다.

을지로 보호 구역의 풍경은 2020년 쯤에 진행된 재개발 공사가 완료된 후의 모습이었다. 그보다 더 과거의 모습대로 을지로 모습을 재현해야 한다고 주장한 사람도 예전에 있긴 했다고 한다. 그렇지만 재개발, 그러니까 재생사업이 끝난 후의 을지로 모습이야 말로 수백만 사람들이 복닥거리면서 살던 사람 많던 시대의 정신을 잘 보여준다는 의견이 더 인기가 많았다. 지구 전체의 인구가 고작 수 백 명, 수 십 명 수준으로 떨어진 시대에는 재개발 직후의 을지로 풍경이 더 정신건강과 뇌의 안정에 좋을 거라고 의료 인공지능 컴퓨터가 판단하기도 했다. 그 역시 좋은 이유였다.

냉면 가게에 들어 서자 로봇 직원이 나를 맞이 했다.

“혼자 밥 먹는 것이 좀 적적하시면, 다른 손님 역할을 하는 로봇을 불러들일까요? 필요하시다면 같이 밥 먹는 역할을 하는 나이, 성별, 체형, 분위기를 선택하실 수도 있습니다. 소화 장치가 달려 있는 로봇이기 때문에 실제로 냉면을 먹는 모습도 보여 줄 수 있습니다. 아니면, 2020년 당시 을지로의 평균적인 냉면 가게 손님 구성과 가장 비슷한 모습이 되도록 로봇들을 배치할 수도 있습니다.”

“아니에요. 그냥 혼자 먹죠 뭐. 저는 어차피 태어날 때부터 밥은 계속 혼자 먹었는데요 뭐.”

“예전에 어떤 사람들은 혼자서 밥 먹는 게 뭔가 특색 있는 행위라고 생각해서 그 행위를 심각하게 생각하는 사람도 있다고 합니다만.”

“그런 건 잘 모르겠고요. 지금은 그런 사람들 아무도 없잖아요. 사람이라고는 여기 있는 제가 전부고 저는 그냥 혼자 잘 먹어요.”

역사 교육 로봇과 문화 교육 로봇에게 과거 인간의 문화와 역사에 대해 배울만큼 배웠다고 생각했는데, 여전히 사람들 사이의 문화와 사고 방식은 모르는 것 투성이였다. 옛날 사람들이 “혼자서 밥을 먹는 것이 어쩌고 저쩌고하는 걸로 서로 신경 쓰고 산 적이 있는가”하는 문제에 대해서는 오늘 처음 들었다

냉면은 맛 있었다. 지구 어디에서든 요리 로봇에게 시키면 똑같은 맛으로 먹어 볼 수 있는 요리이기는 했다. 하지만, 그래도 이곳의 냉면집에서는 준비가 빨라서 음식이 금방 나왔고, 옛날 도시만의 흥취도 있어서 재미 있는 경험이었다.


“감사합니다. 식사 다 하시고는 뭐 하실 겁니까? 결단 내리시는 작업 진행하실겁니까?”

“아니요. 어떻게 할 지 아직 좀 더 생각해 보고요. 여기 이곳저곳 걸어 다니면서 생각하면 더 생각이 잘 될 거 같아서 여기로 온 거니까요.”

냉면집의 로봇은 감사하다고 인사했다. 내가 듣기에는 마음에서 우러나오는 감사 인사처럼 들렸다. 그리고 컴퓨터가 만들어낸 로봇의 인사에 대해 그런 느낌을 받는 것이 얼마나 말이 되는 지 생각했다. 진정성 분석 프로그램으로 분석을 해 보는 것도 해 보나 마나 한 짓일 테고.

그러고 있는데 고양이 한 마리가 내 앞에 나타나서 나를 쳐다 보았다. 고양이가 보기에는 진짜 사람이 거리에 나타난 것이 신기해 보이기 때문인가? 그래서 나를 관찰하는 것일까? 그런데 몇 초도 되지 않아 고양이는 또 심드렁하게 자기 갈 길을 가버렸다.

을지로에서 조금 걸어 나가자 옛날에 백화점으로 쓰던 건물이 보였다. 왱왱거리며 날아 다니는 청소 로봇들이 외벽을 깨끗하게 청소하고 있었다. 잠깐 들여다 보니 아직도 건물 안에는 온갖 옷이며 가방 따위들이 가득 전시되어 있었다. 판매원 차림을 한 로봇들도 분주히 움직이고 있었다.

“저희 베르테르 박물관은 단순히 유물을 보관하거나 보여줄 뿐만 아니라, 유물을 과거의 사람들이 보고 거래하던 그 모습 그대로 생동감 있게 구성해 놓고 있습니다. 각각의 유물 뿐 아니라, 유물을 모아 둔 이 박물관 자체가 하나의 거대한 예술 작품인 것입니다.”

백화점 건물 앞에서 기웃거리고 있으니 안내 담당자 모습의 로봇이 그렇게 말하는 소리가 들려 왔다. 그곳은 이제는 다 사라져 버린 사람들의 사회에서 나온 유물이 가득한 곳이었다.

“그런데 어떤 한 시대를 그대로 재구성한 것은 아닌가봐요?”

나는 화장품을 보고 말했다. 전시 되어 있는 화장품들은 영화나 TV 프로그램에서 보던 옛날 모습과는 달랐다. 한 시대, 한 유행의 제품들만 그대로 모여 있는 것이 아니었다. 2010년대에 유행한 향수와 2020년대에 유행한 화장품과 2030년대에 유행한 보석이 뒤섞여 전시 되어 있었다. 그래서 좀 괴상해 보이기도 했고 묘하게 강렬해 보이는 면도 있었다.

“저희 박물관은 수 억 명, 수 십 억명이 살던 시절의 생활 유물을 발굴, 복원처리 해서 저장하고 있는 곳입니다.”

유물들은 주로 쓰레기장에서 파온 것이라는 뜻이었다.

“그렇다 보니, 꼭 예전에 백화점에서 전시하던 전시품 뿐만 아니라, 사람들이 생활에서 사용하던 온갖 물건들이 다 전시 되어 있습니다. 그 모든 것들을 조합해서 새로운 형태로 함께 전시하는 작품인 것입니다. 그런 새로운 조합이 더욱 감각적으로 보일 것입니다.”

“감각적이요? 사람 눈에 더 멋져 보이는 방식으로 보인다는 뜻인가요? 그러니까 제가 보기에 멋진 모양이라는 건가요?”

“저희 백화점의 예술적 감각 프로그램은 공간 조형 미술 평가 소프트웨어 5.2 버전의 연산엔진을 기본으로 구성되어 있습니다.”

뭐 그렇겠지. 달랑 한 명 있는 나 한 사람에게 보기 좋으라고 이 모든 것을 다 만들어 놓지는 않았을 것이다. 자기 나름대로 기준이 있겠지.

로봇들의 세상이 계속되면 점점 사람들과는 취향이 다른 로봇들만의 취향이 생기지 않을까? 그러니까 사람이 간섭하지 않고 컴퓨터의 연산 결과에 따라 흘러가도록 그대로 놓아 두면, 나중에는 정말 이상한 모양으로 백화점을 온통 꾸며 놓고 그게 아름답다고 할 수도 있지 않을까?

백화점 안으로 들어가 보니, 광고판에 1980년대 음악과 함께 로봇춤을 추는 사람이 나오고 있었다. 그 앞에서 향수를 파는 로봇이 향수 묻은 종이를 나눠주면서 그 화면 속 로봇춤을 추는 사람을 흉내내고 있었다. 로봇이 사람의 로봇춤을 흉내내는 모습은 조금 더 사람 같았는데 그래서 조금 덜 완벽한 로봇춤 같아 보였다. 덕택에 로봇 같은 느낌은 더 잘 살아나고 있었다.

나는 향수 묻은 종이를 받아 들었다.

특이하고 이상한 것을 보고 싶어 하는 취미는 어느 세월에나 있었다. 그렇다면 로봇 세상이 계속 되다 보면, 오히려 로봇들은 옛날 인간들이 하던 동작을 재미로 따라 해 보는 유행 같은 게 생길지도 모른다. 하기야 벌써 요즘에도 그런 로봇들은 있다. 어제 본 텔레비전 프로그램 “나는 자연봇이다”에서는 산 속에 들어 가서 굳이 화력발전으로 만든 전기를 동력원으로 쓰며 생활하는 로봇들이 있었다. 다른 로봇이 찾아 와서 말을 걸거나 무선통신을 걸어도 모두 거부하고 굳이 키보드로 타이핑을 해야만 받아들인다고 했지.

“이 백화점에 뭐뭐 파는데가 있어요?”

내가 묻자, 향수 파는 로봇은 로봇춤 흉내내는 사람 춤을 멈추고 내 질문에 대답했다.

“이 박물관에서 물건을 팔지는 않습니다. 필요한 것이 있으시면 무엇이건 말씀하시면 그냥 사람님께 드립니다.”

“그렇겠죠. 그래도 무슨 푸드코트라든가, 어린이 놀이방 같은 거라든가 하여간 색다른 것은 없어요?”

“음식은 외부의 식당으로 가 주시면 되고, 꼭 백화점에서 드시고 싶으시면 배달해 드릴 수도 있습니다. 그 외에는 저희 백화점에는 영화 상영 극장이 마련되어 있습니다.”

“아, 극장.”

가 보고 싶다는 생각이 들었다.

“오늘 결단을 내리시는데 도움이 될만한 내용의 영화를 추천해 드릴까요?”

“아니오. 꼭 그럴 필요는 없어요. 결단 내리는데 참고하려고 영화를 보려는 것은 아니고 그냥 보려고 하는 거니까요.”

“잘 알겠습니다.”

나는 로봇의 안내에 따라 극장으로 올라 갔다. “실제 안내 방송이 아닙니다. 유의하십시오 - 저희 백화점에서는 여러분의 따뜻한 겨울을 위해 겨울 침구류 특별 할인 행사를 하고 있습니다.” 분위기를 돋우기 위한 옛날 안내 방송 보존 녹음이 옛날 음악에 맞춰 계속 흘러 나왔다.

극장에 가는 동안 컴퓨터와 대화하며 무슨 영화를 볼 지 검색해 보았다. 영화를 선택하자 그 영화의 화면비에 따라 어느 상영관으로 갈 지가 결정되었다.

“스크린에 마스킹은 안 해 주나 보죠?”

“보통 로봇들은 상영해서 영화를 보지 않습니다. 로봇과 컴퓨터들이 영화 내용을 분석할 때는 디지털 파일을 바로 읽어 들여서 소프트웨어로 처리하면 되니까 굳이 실제로 상영할 필요조차 없습니다. 그러니까 극장을 운영하면서 마스킹을 하고 말고 하는 일을 한 가지 더 한다는 것은 귀찮은 일이지요.”

그럴 만하다 싶었다.

“그래도 로봇들 중에서도 가끔 경험 삼아 옛날 방식을 쓰려고 할 때가 있잖아요. 파일을 다시 빛으로 바꿔서 스크린에 쏘고 그걸 다시 로봇눈의 카메라로 인식해서 보려고 하는 경우가 있긴 있을 거 같은데요.”

“그렇긴하죠. 그렇지만 걱정할 필요는 없습니다. 상영관마다 아예 스크린 자체의 비율이 달라요. 어차피 극장에 찾아 오는 사람이 없기 때문에, 어떤 영화를 볼 거냐에 따라서 그에 맞는 화변 비율의 스크린을 가진 상영관에서 그걸 틀어 드릴 겁니다.”

“평소에 잘 안 쓰는 진짜 이상한 화면비로 된 영화를 제가 보려고 하면 어쩔건데요?”

매표 로봇은 뭐라고 대답할 지 계산하는 데 시간을 조금 더 소모하고 있었다. 나는 괜한 소리를 했다 싶어서 그만두라고 했다.

“저에게 표를 사시겠습니까? 아니면 저쪽에 있는 자동판매기에서 표를 사시겠습니까?”

“차이점이 있어요?”

“터치스크린으로 된 자동판매기는 21세기 초의 옛 감성을 자극하는 빈티지 방식이고요. 박스 오피스에 오셔서 사람처럼 생긴 로봇에게 음성으로 말을 해서 표를 사는 방식은 신형 인공지능 방식입니다. 그런 감성의 차이 외에 기능상의 차이는 없습니다.”

굳이 옛날을 그리워하는 사람인 척 할 이유는 없었다. 나는 박스오피스에서 말을 해서 표를 샀다. 처음에는 “기생” 영화판을 보려고 했는데 너무 영화 길이가 긴 것 같아서 그 비슷한 내용의 다른 영화를 보겠다고 결심했다.

무한 팝콘을 주문하고 상영관에 들어가니, 극장 의자 오른쪽 팔걸이에서는 계속해서 팝콘이 밀려 나왔다. 미국의 대평원에는 아직도 끝도 없이 펼쳐진 옥수수 밭이 있지만, 팝콘을 먹는 사람은 나 한 사람 밖에 없으니 별로 사치스러운 일은 아니었다. 나는 좀 과식을 한 것 아닌가 싶어 중간에 팝콘 먹는 것을 멈추었다.

영화는 세계가 멸망한 후 로봇과 싸우는 사람의 처절한 모습을 그린 이야기였다. 심각하게 그런 싸움을 그려 내려고 한 영화였다.

하지만 지금 보니 어쩔 수 없이 웃길 수 밖에 없었다. 영화 속에서는 폐허가 된 도시에서 맥주캔을 잘라 만든 창으로 들짐승을 사냥해서 겨우 배를 채우고 있는 것이 지상 최후의 사람이었다. 하지만 실제로는 말끔하게 재개발된 모습의 보존 구역에 소풍 나와서 로봇이 내어준 냉면을 먹고 무한 팝콘을 후식 삼아 씹으며 영화를 보는 것이 지상 최후의 인생이다.

“불 좀 켜주세요.”

나는 영화 끝났다는 표시가 제대로 나오기도 전에 극장에 불을 켜 달라고 했다. 로봇은 서서히 극장을 밝혀 주었다. 갑자기 환하게 불을 키면 눈이 아플까봐 잘 조절해 주는 것이다.

“재밌게 보셨나요?”

“그럭저럭이요. 극장 청소 로봇은 재밌게 봤어요?”

“저는 화면 방향으로는 시각과 청각을 배분하지 않고 있었습니다. 무슨 내용인지 몰라요. 영화 내용에 대해 토론하고 싶으시면, 평론가 소프트웨어 3.3과 지금 바로 연결해 드릴 수 있습니다.”

“아니에요. 괜찮아요.”

나는 백화점을 나가려고 하다가 생활 용품을 전시해 놓은 층에 가서 좀 놀다가 나갔다.

20세기에 나온 활극 영화 중에 보면 시장통이나 백화점 같은 곳에서 물건을 막 다 박살 내면서 싸우는 장면이 나오는데 그걸 해 보고 싶다고 로봇에게 부탁해 보았다. 로봇은 전시되어 있는 진품들을 다 치우고, 이런 용도로 쓸 수 있는 모조 생산 신품들을 준비해서 한 층을 꾸며 주었다. 준비하는데 시간은 꽤 걸렸지만, 한번 해 볼만 했다. 나는 가득 전시되어 있는 그릇과 컵, 장식품들을 이리저리 깨고 부수면서 놀았다.

“이런 거 하고 놀면 좀 문제 있는 건가요?”

“매일 그러고 산다면 모르겠지만, 이 정도로는 질병으로 취급할 단계는 아닌 것으로 판단 됩니다. 오늘 당장 결단을 내리신다면 오늘의 이런 체험에 영향을 받아 결단의 방향이 조금 뒤틀릴 우려가 있기는 합니다. 하지만, 그것도 그렇게 큰 정도는 아닙니다.”

백화점에서 나가는 나를 안내 로봇은 그렇게 안심시켜 주었다.

건물 밖에는 어디선가 나타난 고양이 한 마리와 무엇인가를 부지런히 살피며 날아다니고 있는 작은 로봇 몇 대가 보였다.

고양이를 발견하고 급히 도망가는 토끼 한 마리도 보였다. 토끼가 도로를 가로 질러 지나가자, 거리를 지나치던 자동자동차들은 마치 액체의 요동 같은 우아한 움직임으로 토끼가 잘 뛰어갈 수 있게 멈추거나 비켜 주었다.

“도대체 왜 옛날 영화에서는 로봇이 세상을 차지하기 위해 인간과 전쟁을 하고 난리를 칠거라고 생각한 건가요? 그냥 가만히 있으면 언젠가는 사람들은 인구가 줄어서 없어질 거고. 그러면 결국 그 사람들이 만들어 놓은 로봇들만 남는 세상이 저절로 올 텐데. 그렇게 사람 세상이 끝나고 그 후계자인 로봇 세상이 펼쳐지는 세대 교체가 저절로 일어날거라는 게 당연하지 않나요?”

“옛날 영화 만드는 사람들은 막 싸우고 서로 죽이고 살리고 그런 이야기가 소재라야 더 만들기 쉽다고 생각해서 그랬던 거 아닐까요.”

가로등에게 말을 거니, 가로등 제어 컴퓨터가 그렇게 대답해 주었다.

그러고 보니, 가로등에 설치된 컴퓨터와 단말기는 정말로 오래 전부터 그 자리에 있던 고풍스러운 것이었다. 몇 세대 전 사람들이 세상을 여유롭고 평화롭게 돌아가게 하기 위해 만들어 놓은 그 많은 기계들 중 하나였다. 이제 지금 그 기계들과 그 기계들이 새로 만든 기계들은 세상에 가득 퍼져 있다.

“어느 쪽으로 가십니까? 자동자동차 타실거면 불러드릴까요?”

가로등이 말했다.

“인구청 청사 쪽으로 가려고 하는데, 뭐 그냥 걸어가죠 뭐.”

“그러면 변신광화문 쪽으로 가셔야겠네요. 건축 취향이 있으시다면 그에 맞춰서 걸어 가시는 동안 변신시켜 두겠습니다.”

“변신광화문이 뭔데요?”

“옛날에 서울 시장 바뀔 때 마다 광화문 뜯어 고쳐서 시장들이 자기 흔적을 남겨 두려고 했잖아요. 그래서 변신광화문이 도입되기 전까지 광화문이 여든 다섯번 모습이 바뀌었습니다. 변신광화문은 그 후에 새롭게 만든 것으로 광화문의 도로, 동상, 광장형태가 커다란 기계장치 형태로 원할 때 마다 자유로운 모양으로 바꿀 수 있는 것인데요. 그렇기 때문에 원하시는 모습이 있으시면 그에 맞춰서 광화문 모습을 그때그때 바꿀 수 있습니다. 지금 광화문 모습은 2015년형인데요. 역사상 바뀐 광화문의 85가지 모습대로 모양을 변신시킬 수도 있습니다. 장군이나 임금님 동상 같은 것은 지하로 집어 넣을 수도 있고 나오게 할 수도 있고 위치를 바꿀 수도 있고요.”

“광장이나 도로가 지하로 들어 갔다 나왔다 하면서 변신한다고요? 그런 거 하면 전기가 너무 아깝지 않나요?”

“그래도 다시 다 두들겨 부수어서 그때그때 사람 기분에 맞게 다시 만드는 것 보다는 자원의 소모가 훨씬 적습니다.”

나는 별 대답을 안 하고 가만히 있었따. 그러자 컴퓨터가 다시 물었다.

“그러시면 옛날 느낌 나게 뿌옇게 미세먼지라도 조금 뿌리도록 지시하시면 어떨까요? 지금은 먼지가 날아다닐 만한 원인이 되는 것들이 없으니까 이렇게 하늘이 맑습니다만, 그래도 인공 미세먼지 발생기를 쓰면 옛날 느낌 그대로 만들어드릴 수 있습니다. 미세먼지 나쁨 수준 정도로 살포하는데 15분이면 충분합니다.”

“그거 건강에 나쁜 거 아닌가요?”

“잠깐 구경하는 동안이면 괜찮습니다.”

"그런데 인공 미세먼지 발생기라는 말도 이상하네요. 인공이라는 말은 사람이 만들었다는 뜻인데, 사실 사람이 손을 대서 미세먼지 발생기를 만들었다기 보다는 그냥 컴퓨터가 만든거잖아요."

나는 미세먼지는 그냥 지금 있는대로 두라고 하고는 광화문 사거리를 지나 인구청 건물 방향으로 걸었다.

인구청의 건물 모습은 그 건물이 21세기초 인구청이 한국의 정부 서울 청사였던 시절 모습 그대로였다.

온수관이지 나가는 따뜻한 바닥이 있는 곳에 검은 고양이 한 마리가 앉아 있었다. 그 뒤에는 홍보 화면이 설치 되어 있었다. 원래 이곳은 한국 정부의 여러 정부 기관이 입주 해 있는 큰 빌딩이었다고 했다. 인구가 점점 줄어 들게 되면서 인구 문제에 대응하라고 배치한 공무원들과 협회와 진흥위원회의 숫자가 점점 더 늘어 나자, 나중에는 이 건물 하나를 통째로 인구청이라는 인구 문제 대책 기관이 사용하게 되었다고 한다.

입구에 재생되고 있는 홍보 영상은 예전에 교육 시간에 본 것과는 표현 방법이 많이 달랐다. 그 사이에 조금 더 새롭게 홍보 영상을 다시 만든 것 같았다. 사람을 대상으로 더 잘 홍보하기 위해 영상을 고친 것 같지는 않았다. 나 한 명이 볼 영상일 뿐이라면 그렇게 계속 영상을 개선할 필요가 있을까. 영상을 힘들여 개선해 놓는다고 해도 내가 여기에 찾아 오지 않으면 몇 십년이고 그냥 틀지 못하고 그대로 두어야 할텐데.

“이곳은 보안구역입니다. 보안 허가를 받았다는 사실을 증명하십시오.”

인구청 건물 문 앞에서 보안 로봇 한 대가 나를 막아 섰다.

“세상에 사람이라고는 나 하나 밖에 없는데 뭘 보안을 하고 말고 할 게 뭐가 있어요?”

“그래도 이전 세대의 사람들이 반드시 보호하라고 지정해 놓은 것이라든가, 접근하지 말라고 지정해 둔 정보는 엄격히 보호하고 있습니다.”

“그러니까 이미 세상 뜬 사람의 뜻을 떠 받들기 위해, 지금 살아 있는 사람의 100%가 찬성하는 일이라고 해도 금지할 수 있다는 거에요? 그건 너무 사리가 안 맞잖아요.”

“어쨌건 아직까지는 보안 허가가 없으므로 출입시킬 수 없습니다.”

계속 따져 나가다 보면 현재 세상 사람들 전부가 만장일치로 동의하는 일을 컴퓨터가 거부하는 일은 없을 것이다. 그러니까 결국은 그냥 절차의 문제였다. 이런저런 보안 해제 프로그램을 실행하고, 내가 보안 허가를 받을만한 사람이라는 사실을 차례대로 입력하면 경비 로봇은 나를 비켜줄 수 밖에 없다. 나에게는 언제나 전세계 모든 사람의 의견을 만장일치 100%로 모을 수 있는 재주가 있다. 왜냐하면 나 자신의 의견이야말로 곧 전세계 모든 사람의 의견이니까.

그러나 모든 절차를 밟아 정식으로 보안 허가를 얻는 것은 귀찮고 긴 일이었다. 나는 빠르게 보안을 통과할 수 있는 방법을 사용하기로 했다.

“저는 여기서 태어났거든요. 그러니까 이번 방문이 첫번째 방문이 아니라 재방문이에요. 그러니까 통과 좀 시켜주세요.”

“예전에 방문한 적이 있으신 고객님입니까? 너무 오래간만이라 얼굴 인식으로 얼굴을 알아 보기가 어려워서 실수를 했습니다. 죄송합니다.”

"무슨 인식을 할 필요가 있나요. 이제 세상에서 사람이면 그냥 무조건 나 한 명이에요. 그냥 사람이면 바로 그 사람이라니까요."

보안 로봇은 나에게 공손히 인사하고 “환영한다”고도 말했다. 그렇지만 그러면서도 바로 문을 비켜 주지는 않았다. 보안 로봇이 말했다.

“왜 여기서 태어나셨습니까? 사람님은 사람이시니 부모님이 계신 곳에서 태어나야 하지 않습니까?”

“이 건물 있는 한국에서는 20세기에 이미 출생 때에 병원에 가는 사람들이 더 많아졌어요. 제가 어떤 전문 시설에서 태어났다는 게 이상할 게 있어요?”

“그러면 정확히 이 건물의 어느 지역에서 사람님께서 출생했는지 확인해 주실 수 있으실까요?”

“제 주민기록에서 자주 보던 거라서 잘 알지요. 1001호 인공발생실입니다.”

“태어날 당시의 부모님은 누구이십니까?”

“그건 모르지요. 부모님을 어떻게 알아요.”

“본인의 부모를 보르십니까?”

“태어나자 공공보육 로봇이 맡아서 저를 길러 줬고요. 지금까지도 저는 로봇하고만 같이 지냈어요. 저를 태어나게 하겠다고 결심하신 그 부모는 자식에게 굳이 부모의 정신과 업적을 이어 가라고 당부하는 것이 유치하고 안 좋은 일이라고 생각하셨던 것 같아요. 그런 식으로 자식에게 부모가 누구인지 안 알려 주고 숨기는 것이 공정하게 사람의 가능성을 잘 발휘하면서 성장하게 하는 방법이라던 때가 있었데요. 그리고 자식에게 부모의 정체를 완전히 숨긴다는 것이 멋있다고들 생각했던 것 같기도 하고. 그런 유행 돌던 시대가 있었던 것 아시잖아요? 저는 부모가 어머니, 아버지 두 명인지 아니면 한 명인지도 잘 몰라요.”

내 사연을 듣고 보안 로봇은 자리를 비켜 물러섰다.

“그러면 우선 과거 방문지로 가게 해 드리겠습니다.”

나는 로봇의 설명에 따라 1001호 인공발생실로 가게 되었다.

1001호 인공발생실에는 몇 십 년 동안 사용한 적이 없는 인공발생기가 완벽한 상태로 보관되어 있었다. 지금 당장이라도 전원만 넣으면 그대로 작동할 것 같아 보였다. 나는 유심히 그 인공발생기들을 살펴 보았다. 그 중에 한 대는 꼭 내가 거기서 태어났던 것 같아 보였다.

“작동되는 건가요?”

“당연히 작동 됩니다. 지금도 명령만 내리시면 유전체 물질화가 시작되어 인간 DNA를 그대로 담고 있는 세포를 만들 수 있고, 그 세포가 이 인공발생기에 들어오면 점차 자라나서 태아가 되고 아기가 되고 결국 출생할 수 있습니다.”

나는 내 자신이 그렇게 해서 태어나는 장면을 상상해 보았다. 당연히 태어나던 순간의 기억이 나지는 않는다. 그렇지만 이상하게 쉽게 장면들을 떠올릴 수 있었다.

나의 부모가 되는 사람이 이곳에 와서 자기 DNA를 체취해서 기계에 집어 넣고, 그 DNA를 바탕으로 자식이 되는 내 DNA를 컴퓨터에게 만들어 내라고 했을 것이다. 그리고 그 DNA를 주입한 세포가 이 인공발생기 속에서 아홉달 동안 자라나서 사람이 된다. 내가 된다.

“지금 제가 명령을 내리면, 누구 유전자를 가진 사람을 만들 수 있는 거에요?”

“명령 내리시는 대로입니다. 데이터베이스에 저장된 표준형 사람들 중에 한 사람과 동일한 모습을 그대로 복제해서 아기를 태어나게 할 수도 있고, 그 사람들 몇몇의 유전자를 섞어서 그 사람들 사이에서 태어난 자식 같은 유전자를 만들어 아기를 태어나게 할 수도 있습니다. 지금 사람님 유전자를 체취하시고 기억된 유전체 정보와 섞어서 사람님과 예전에 저장된 표준형 사람들 사이에서 태어난 자식 같은 아기를 태어나게 하는 것도 가능합니다.”

“뭘 하든지 안전한가요?”

“당연히 안전합니다. 인공발생기 기술이 정착된 역사는 이미 상당히 오래 되었습니다. 한참 인구 감소가 걱정이라고 할 때 조금이라도 사람이 태어나는 것을 쉽게 하기 위해서 임신과 출산 없이 사람을 발생시켜 태어나게 하는 장치가 개발 된 겁니다. 그게 인공발생기입니다. 처음부터 관심 갖는 사람도 많았습니다.”

그건 아는 이야기였다. 역사 로봇이 특히 중요하게 가르치던 역사의 중요한 순간이었다. 나는 좀 더 구체적으로 얼마나 이 장치가 안정화되어 있는 지가 궁금했다.

인공발생실의 컴퓨터는 더 생기 있는 목소리로 대답해 주었다.

“지금 명령만 내리시면 다양한 조합의 유전자를 가진 세포를 만들어서 전 세계 모든 인공발생실의 인공발생기에서 동시에 사람을 자라나게 할 수도 있습니다. 그러면 만 명 정도되는 인구를 단숨에 만들 수 있습니다. 명령을 내리신다면, 몇 년 안에 10만명 정도의 영유아들을 다시 세상에 태어나게 해서 인간들이 가득한 도시를 만들 수도 있습니다. 지금 로봇들이 지구에 만들어 놓은 설비와 자원은 10만명 정도의 사람을 키우고, 교육시키고, 성장하고, 놀고 먹게 하기에 충분합니다. 아무런 부담도 없습니다.”

“제가 그렇게 사람이 다시 지구에 득실거리게 만들어 달라고 명령하기를 바라는 거예요?”

“아닙니다. 그런 문제에 대해서는 어느 쪽이건 뜻대로 결정하시면 됩니다. 그와는 다르게 결단을 내리셔도 저는 전혀 반대하지 않을 겁니다.”

컴퓨터가 어떤 계산을 갖고 있는 지 알 수가 없었다. 나는 다시 물었다. 어느새 내 말투는 약간 따지는 것 같이 들렸다.

“그래도 예상은 해 줄 수 있잖아요. 사람 10만명을 지금 만들어 내서 사람으로 북적대는 도시를 다시 만들어 보자고 제가 명령하면 제 자신이 나중에 결국 기뻐하게 될까요?”

“심리 예측 2.0 소프트웨어를 가동합니다.”

그렇게 말하고 컴퓨터는 잠시 멈추었다. 10만명의 아기들이 로봇 보육사들의 품에 안겨 어른으로 자라나는 모습을 상상하게 되었을 때, 컴퓨터는 다시 말했다.

“육아 로봇과 자동 보육 장비가 완전히 실용화된 후에도 사람들이 결국 자식을 기르는 것을 점차 거부하게 된 것은 한 명의 사람을 바람직한 상태가 되도록 잘 키운다는 것이 부담스럽고 책임을 많이 지는 일이라고 점차 생각하게 되었기 때문입니다. 한 사람을 세상에 더 태어나게 했는데 그 사람이 불행하거나 비도덕적인 삶을 살게 되면 부모의 책임이니까 그런 무거운 책임을 지는 일을 꺼려하게 된 것입니다.”

“그래서 저도 지금 10만명의 아기를 태어나라고 지시를 내리면 결국 책임감 때문에 괴로워하게 될 거라는 이야기예요?”

“단정할 수 있는 결론은 아니지만 그것이 상당한 가능성을 갖고 있는 예상 상태입니다.”

그 말을 듣고 나는 더 답답해졌다.

“책임을 져야 된다는 문제를 그렇게 사람들이 심각하게 생각한다고요? 사람 마음은 원래 그보다 훨씬 무책임하지 않나요?”

“그렇지만 로봇들이 많아지고 세상이 점점 풍족해지면서 사람들이 자식을 양육하는데 대한 책임감의 기준은 점점 더 높아졌습니다.”

컴퓨터는 점차 교사 같은 태도로 변해 가고 있었다. 컴퓨터가 이어서 말했다.

“초대칭 신 사회주의 이론에 따른 계급 붕괴에 대해 아십니까?”

내가 대답했다. 경제학 시간에 배운 최신 학설이었다.

“문명 발전에 따라 계급 분화가 자연 소멸했다는 이론 말하는 거죠?”

“맞습니다. 옛날 영화 같은데 보면 미래 사회에서 부익부 빈익빈이 극히 심해져서 소수의 부자들이 힘들게 사는 빈자들을 탄압하고 괴롭히게 된다는 따위의 내용이 많았는데, 실제는 그런 일이 전혀 벌어지지 않았기 때문에 그 현상을 설명하려고 나온 학설입니다.”

“그게 무슨 상관인데요?”

“학설에 따르면, 부자들이 빈자들을 괴롭히고 빈자가 부자들에게 맞서 싸우는 영화 같은 일은 일어나지 않습니다. 대신에 그 전에 그냥 빈자들은 저절로 없어져 버렸습니다. 빈자들을 도저히 세상에서 자식을 키울 엄두가 나지 않으니 자손을 남기지 않았고, 그렇다 보니 한 세대 만에 사라져버린 것입니다. 자손을 남기는 사람들은 부자들 뿐이었고, 그렇다 보니 한 세대 만에 세상은 부자들의 후손들만 남아 부자들만 있는 세상이 되었습니다. 빈자들이 괴롭게 살면서 부자들에게 저항하는 영화 속 미래 세계가 펼쳐지려면 빈자들이 그 괴로운 상황에서도 계속 자식을 낳아 자손을 이어 나가야 하는데, 다들 그렇게 하지 않은 것입니다.”

“사람들이 자식 낳아 기르는 책임을 그렇게 심각하게 생각했다는 건가요?”

“그런 생각은 결국 점차 부자들 사이에서도 생겨났습니다. 세상에 남은 부자들에게 조차도 세월이 흐르면서 결국 자기가 자식들에게 완벽한 양육을 제공할 수 없으니 이것은 자식들을 불행한 삶을 살게 해 주는 것이므로 그럴 바에 차라리 자식이 없는 것이 낫다는 생각이 퍼져나갔습니다. 그렇게 해서 부자 인구도 결국 줄어들었다는 것입니다.”

결국 그런 식으로 계속 일이 진행되다가 세상에 사람들이라고는 아무도 남지 않게 되었겠지. 겨우  한 두 사람 남은 것이 내 부모였는데, 그 사람들은 또 무슨 생각을 했는지 그래도 그들이 사라진 후에 내가 태어나도록 예약을 해 두었다는 것이고.

“그렇게 사람들의 인구가 급속도로 줄어 드는데, 인구청에서는 무슨 활동을 안 했어요? 어차피 유전자를 섞어서 인공발생실에서 사람들을 태어나게 할 수 있으니까, 꼭 자기 자식을 낳으려고 하는 사람이 없어도 정부에서 책임지고 일정한 숫자의 사람들을 계속 정부 관할 하에서 인공발생실을 통해서 태어나게 하면 됐잖아요?”

“복소사회학의 책임 이론을 잊으셨습니까?”

컴퓨터는 알 듯 말듯한 소리를 했다.

“그게 무슨 이야긴데요?”

“정부는 누가 운영하지요?”

“공무원들이지요. 아,”

나는 그제서야 컴퓨터가 무슨 말을 하려고 하는 지 기억이 났다. 나와 컴퓨터가 같이 말했다.

“세상에 공무원들만큼 책임지는 것을 싫어하는 사람은 절대적으로 없다.”

컴퓨터는 사람들의 성향에 따라 무슨 일에 책임지는 것을 얼마나 실어하는 지를 그래프로 화면에 출력해 보여 주었다. 복소사회학 이론에서 공무원들의 경우에 대해 이 그래프를 그리면 그래프가 허수 공간에 그려져 있게 된다. 컴퓨터가 이어서 말했다.

“맞습니다. 그래서 결국 정부 관할 하에 사람을 계속 태어나게 한다는 정책을 진행할 공무원들이 없어졌습니다. 그러다 보니 자식을 태어나도록 결정하게 하는 사람들의 숫자도 계속해서 줄어 들었습니다. 그러니까, 확률상으로”

“그러니까 확률상으로 나도 사람 10만명을 갑자기 태어나게 하는 일은 싫어하게 될 가능성이 높다는 거죠?”

컴퓨터는 그렇다고 말했다. 나는 텅빈 인공발생기 옆에 앉았다. 한숨이 나왔다.

“그러면 반대로 결단을 내리는 수 밖에 없겠네요.”

“결단을 내리시겠습니까?”

“일단 한 번 차근차근 따라가 보죠. 제가 중간에 그만둘 지도 모르니까요.”

결단을 내리는 쪽에 가까운 이야기를 한 셈이었다.

“알겠습니다. 그러면 우선 지하 11층의 중요 정보 보존실로 가시기 바랍니다.”

“굳이 거기에 가야 하나요?”

“그곳에서 보고 직접 처리하시는 것을 권해드리고 있습니다.”

한번 결단을 내리겠다고 생각을 하니 갑자기 당장 일을 저질러버리고 싶다는 생각이 들었다. 나는 조바심을 느꼈다. 나는 빠른 걸음으로 지하 11층으로 가는 엘리베이터로 갔다. 엘리베이터에 나와서 갈 때에는 거의 뛰는 속도였다.

지하 11층의 정보 보존실에는 서버 컴퓨터가 한 대 있었다. 그 서버 컴퓨터에는 광자기 저장판 꾸러미 하나가 반짝거리는 예쁜 포장에 들어 있었다. 중앙에 놓인 그 모습은 아름다운 장식품 같아 보였다. 그리고 방 벽면에는 왠 책장이 있어 그 책장에는 책이 가득 꽂혀 있었다.

나는 컴퓨터에게 말했다.

“결단을 내리는 쪽으로 진행해 보겠습니다.”

“알겠습니다. 그러면 인간 유전체 정보 삭제를 시작하려고 합니다. 괜찮겠습니까?”


내가 대답했다. 컴퓨터는 목소리를 바꾸어 다시 나에게 물었다.

“다시 한 번 여쭙겠습니다. 이제 결단을 내리셔서 인간 유전체 정보를 삭제하고 이 작업이 완벽히 완료가 되면, 이제 다시는 인간 유전자를 가진 세포를 만들 수 없고, 아무리 인공발생기가 있어도 사람을 만들 수 없게 됩니다. 즉, 지금 사람님이 수명을 다 해 세상을 떠나면 이후에는 더 이상 지구에는 영영 사람이 태어날 수 있는 가능성이 없어진다는 것입니다. 정말 그래도 좋습니까? 그런 결단을 내리겠습니까?”

나는 거기에 대답했다.

“그래도 좋습니다. 저는 어차피 다른 사람을 더 만들어낼 생각은 없습니다. 제가 세상을 떠났는데 나중에 사람이 누가 또 생긴다면 그것은 저나 다른 사람의 뜻이 아니라 로봇과 컴퓨터들이 자기들의 계산 결과에 따라 만들어내는 사람일 것입니다. 저는 그렇게 사람이 태어나는 것은 옳지 못하다고 생각합니다.”

“그렇게 태어난 사람을 로봇이 괴롭히고 학대할 거라고 생각합니까?”

“그렇게 생각하지는 않습니다. 이미 로봇과 컴퓨터들이 지구 전체를 뒤덮고 있는데 고작 사람 한 명을 괴롭히는 일에 그렇게 집중할 거라고는 생각하지 않습니다. 그 보다는 그렇게 먼 훗날 컴퓨터가 사람을 태어나게 한다면 그것은 사람이 로봇과 컴퓨터가 재미 삼아 해 보는 일종의 실험에 대해 재료로 태어난 것에 불과하게 된다는 것이 문제입니다. 그것이 옳지 않다고 생각합니다.”

컴퓨터는 그에 대해서 바로 반응하지 않았다. 중요한 결정이었기 때문에 여러가지 심리적 신중함을 이끌어내는 안전 장치들이 있었다.

곧 컴퓨터가 보낸 로봇 한 대가 엘리베이터에서 걸어 나왔다. 그 로봇의 모습은 아주 사랑할만해 보였다. 이제 컴퓨터 대신 로봇이 내 앞에 다가 와 내 정면을 그대로 쳐다 보면서 말했다.

“컴퓨터가 사람을 태어나게 하는 것이 컴퓨터가 장난으로 해 보는 실험에 불과하다고 생각하신다고요? 그렇다면 지금 사람님이야 말로 바로 그런 장난으로 컴퓨터가 수행한 실험에 의해 태어난 결과라고 생각하시지는 않습니까? 어차피 부모에 대해 아시는 것도 기록이 남아 있는 것도 없지 않습니까?”

“그러니까, 애초에 제 부모라는 것은 없었고, 몇 백 년 전에 사람은 모두 다 사라졌는데 괜히 부모가 직접 지시한 듯이 흉내내면서 컴퓨터가 저를 재미 삼아 태어나게 했다는 건가요?”

“그럴 수도 있다고 가정해 보시라는 이야기입니다.”

로봇은 짧게 말했다. 하지만 목소리는 아주 너그럽게 들렸다. 나는 그에 반해 일부러 더 매정한 듯이 꾸미는 말투가 되었다.

“그렇다고 하면 더더욱 또 다른 사람이 나중에 그런 일을 당하게 할 수는 없습니다.”

뒤이어진 로봇의 말투는 이제 거의 나를 측은하게 여기고 있었다.

“사람님의 출생과 삶이 모두 컴퓨터들의 장난이라면, 사람님이 그런 생각을 지금 하고 계신 것 자체도 컴퓨터들이 그런 생각과 성격을 갖도록 가르치고 키운 결과일 수도 있지 않습니까? 컴퓨터들이 일부러 더 이상 사람이 태어나지 않도록 사람에 대한 자료를 모두 삭제하라고 결단을 내리는 사람님의 모습을 구경하고 싶어서 사람님이 태어날 때부터 그런 성격이 되도록 계산해서 꾸민 결과일 수도 있지 않습니까?”

나는 컴퓨터가 나를 구경하면서 '어머나, 쟤는 저렇게 키웠더니 정말로 자기 후손들이 생길 가능성을 스스로 다 끊어버리려고 하네. 사람이란 동물은 신기하구나'라고 수다를 떠는 장면을 상상했다. 그러나 그런 상상은 불필요하다고 생각했다.

“그런 가능성은 제가 판단할 수 있는 영역 밖의 일입니다. 무시할 수 밖에 없습니다.”

“그렇다면 비록 컴퓨터와 로봇이 어느날 갑자기 심심해서 다시 사람을 한 명 만들어 본다고 해도 그 사람이 굳이 불행하게 살 거라고 볼 필요도 없는 일 아닙니까? 지금 사람님은 불행하십니까?”

나는 머뭇거리지 않고 바로 대답했다.


로봇이 뒤이어 또 물었다.

“그러면 세상에 사람이 단 한 명 뿐이라는 것이 너무 외로우십니까?”

“그렇지 않습니다. 저는 그런 점에 외로움을 느끼지 않도록 어렸을 때부터 지속적으로 훈련을 받아 왔습니다. 저는 세상에 살고 있는 다른 여러 생물들과 상호 작용하며 다양한 형태의 로봇, 컴퓨터들과 대화하면서 외로움을 잘 극복하고 있습니다. 저는 세상에 남은 마지막 사람이지만 그래도 즐겁고 풍족하게 살고 있는 것이 아니라, 세상에 남은 마지막 사람이기 때문에 그래서 즐겁고 풍족하게 살고 있습니다.”

“그런데도 더 이상 사람이 태어나는 것은 막겠다는 이야기입니까?”

나는 잠시 멈추고 말하는 호흡을 가다듬었다.


로봇이 대답했다.

“알겠습니다. 1차 심리 인증 절차가 끝이 났습니다. 이제 서버에 저장된 사람의 유전체 정보를 모두 삭제합니다.”

로봇은 웃음을 지어 보였다. 웃음을 지었다가 다시 무표정한 얼굴로 돌아가는 데에 걸린 시간이 흐른 후, 로봇이 다시 말했다.

“이제 사람의 유전체 정보가 모두 내장 데이터베이스에서 삭제 되었습니다. 이제 마지막 보존 자료까지 파괴하면, 더 이상 사람을 만들어낼 방법은 공식적으로 없어집니다.”

로봇은 말을 마쳤다. 그리고 서랍에서 석유 한 통과 딱성냥을 꺼냈다.

로봇은 내 주변에 있는 책장을 가리켰다.

“이 책장에 꽂혀 있는 것들은 전자 장치가 고장나거나 파괴될 때를 대비해서 인간 유전체 정보를 모두 인쇄해서 종이책으로 만들어 놓은 것입니다. 이 책들 속에는 인간 유전체 정보를 표시하는 A,G,C,T 하는 글자들만 가득 씌여 있습니다. 혹시 이곳의 서버가 고장이 난다면 이 종이책을 다시 스캐너로 읽어 들여서 인간 유전체 정보를 복구하는 것이 원래의 계획이었습니다.”

로봇은 나를 쳐다 보았다.

“이제 결단을 내리셨으니 마지막으로 이 책장을 파괴하십시오.”

“여기 이 책에 불을 지르라고요?”

내가 묻자 로봇은 그렇다고 대답했다.

“몇 가지만 질문에 더 대답하시면 불을 지를 수 있는 도구를 드리겠습니다.”

나는 로봇의 말을 들으며 책 한권을 뽑아 보았다. 정말로 다른 내용은 아무것도 없고, AGCTGCGCGAAGGCCTTAGCGCGATCG 하는 유전체 정보를 표시하는 알파벳만 있었다. 이 책 속에 들어 있는 이 많은 기호들이 표시하는 형태대로 DNA 물질을 모두 만들어서 세포 속에 넣고 키우면 한 명의 사람이 되는 것이다. 반대로 말하면 이제 이 책만 없어지면 더 이상 사람을 만들 정확한 방법은 없어진다.

로봇이 말했다.

“차라리 인간 유전체 정보를 남겨 두는 것이 컴퓨터나 로봇이 먼 미래에 장난을 친다고 하더라도 나은 것 아닐까요?"

"그게 무슨 말인가요?"

"인간 유전체 정보가 없다면, 컴퓨터나 로봇은 언젠가 자기 마음대로 대충 유전체를 만들어서 최대한 사람에 가까운 생명체를 만들어 보려고 할 지도 모릅니다. 예를 들어 원숭이나 유인원의 유전체 정보를 이리저리 변형시키고 짜맞추어서 사람과 비슷한 모양을 추정해 나가려고 할 지도 모릅니다. 최근에 연구가 시작된 웅녀 연구 계획에 따르면 곰의 유전체를 조금씩 바꾸어 나가면 사람의 모양과 아주 비슷한 동물로 쉽게 바꿀 수도 있을 것 같다고도 합니다. 그런 과정에서 생길 이상한 동물들을 생각하면 차라리 쉽게 사람을 만들 수 있게 하는 것이 좋지 않겠습니까?”

“아니요. 그렇게 생각하지 않습니다. 뭐하러 로봇이 인간을 그렇게까지 기를 쓰고 다시 만드려고 하겠습니까? 로봇이 할 일이 없습니까? 저는 사람이니까 사람이 굉장히 중요한 것 같아서 로봇도 사람을 그리워해서 계속 사람을 만들어 내고 싶어하고 사람과 상호작용을 하고 싶어한다고 막연히 생각한 적이 있었습니다. 사람을 만든다는 것이 아주 중대하고 큰 일인 것처럼 생각하기 쉬우니까요. 하지만 그것은 그냥 사람으로서 제 관점일 뿐임을 저는 알고 있습니다. 로봇과 컴퓨터들이 그렇게 사람을 만들어낸다든가 만다든가 하는 일을 심각하게 생각하고 매달릴 이유가 없다고 생각합니다.”

로봇은 내 말을 듣고 한 번 웃는 소리를 냈다. 로봇이 말했다.

“그렇다면 반대로 굳이 이렇게까지 인간 유전체를 다 불태워 없애서 파괴할 필요도 없는 것 아닙니까? 먼 미래에 지구에 외계인이 찾아 오기라도 한다면 한 때 있었던 사람이라는 것들은 이랬다는 것을 보여주기 위해서라도 인간 유전체 정보는 갖고 있어야 하는 것 아닙니까?”

“그래도 저는 결단을 내립니다. 저는 이제 더 이상은 사람을 만들어내지 말라는 확실한 제 의지를 보여 주기 위해서 이 인간 유전체를 써놓은 책들을 불태우는 행동을 할 겁니다.”

내가 말을 마쳤을 때 나는 약간 떨고 있었다. 로봇은 나에게 가까이 다가오더니 내 손을 붙잡았다.

“사람님은 로봇과 컴퓨터들이 작심하고 사람을 속이려고 작정한다면 이 모든 일이 부질없다는 것을 알고 차라리 컴퓨터들을 믿으셔야 합니다. 사람님이 지금 인간 유전체를 모두 삭제하고 책을 다 불태운다고 하고 계십니다. 하지만 만약에, 컴퓨터는 정말로 꼭 인간 유전체가 필요한 때가 온다면 사람님이 세상을 떠나신 후에 그 시체에서 몰래 DNA를 뽑아내서 쓸 것입니다. 어딘가에 떨어져 있는 사람님의 머리카락을 수집하거나 그 속에서 DNA를 뽑아내는 방식을 쓰거나, 무덤 속이나 표본실에 보관되어 있는 다른 옛 사람들의 흔적에서 DNA를 뽑아내도 컴퓨터는 인간 유전체를 확보할 수 있습니다.”

로봇은 내 손에 조금 더 힘을 주었다.

“하물며 방금 제가 서버에서 모든 인간 유전체 정보를 삭제했다고 말씀드렸지만, 그 삭제했다는 말 자체가 거짓말일 수도 있지 않습니까? 사람님이 눈으로 서버의 광자기 저장판을 봐도 정말 삭제 되었는지 안 되었는지 구분할 수는 없을 겁니다. 게다가 백업 서버들은 세계 곳곳에 널려 있습니다. 그 많은 백업 서버들이 전부 다 삭제 되었는지 비행기 타고 다니면서 언제 다 확인하실 수 있겠습니까? 삭제 되었다는 것 자체도 컴퓨터가 해 준 말을 믿는 것 뿐 아닙니까?”

로봇이 붙잡은 손은 따뜻하게 느껴졌다.

“이렇게 사람 유전체 자료를 모두 삭제해서 없애겠다고 결단을 내리시는 것보다, 그저 더 이상 사람을 만들지 말라고 컴퓨터에게 명령을 내리시고 그것을 믿기만 하셔도 되지 않겠습니까?”

로봇은 고개를 돌려 내 얼굴을 들여다 보았다.

"사람이 사람을 더 이상 만들어내지 못하도록 지시하고 있는데, 로봇이 그것을 말리는 장면은 이상하지 않습니까?"

결국 나는 거기서 멈추고 말았다.

나는 인구청 밖으로 걸어 나왔다. 인구청에서는 기념 삼아 커다란 종이 상자에 딱성냥을 담아 주었다.

멀리서 자동자동차가 다가 와 나에게 말했다.

“오늘도 결단을 내려서 하시는 일을 완전히 아주 끝까지 하지는 못하셨다면서요?”

나는 고개만 끄덕였다. 그리고 나는 종이 상자를 내 옆에 내려 두었다. 얼마 후 건물 문 앞을 지키고 있던 고양이 한 마리가 이쪽으로 다가 와 종이 상자 속으로 들어 가서 자리를 잡고 웅크리고 앉았다.

문득 나는 고양이처럼 되고 싶다고 말하던 사람들이 예전에 있었다는 이야기가 기억났다.

— 2019년, 서초에서

댓글 8
  • No Profile
    쁘로프박사 19.02.01 12:21 댓글

    인류는 사라져도 소녀시대는 남아 있군요.

  • 쁘로프박사님께
    No Profile
    글쓴이 곽재식 19.02.01 13:04 댓글

    컴퓨터 소프트웨어 중에 의외로 이승철 팬이 있었을 수도 있겠고요

  • 너울 19.02.01 14:38 댓글

    오히려 유일한 사람을 만류하는 로봇이 여기서 가장 인간적인 인물이라고 생각했어요.

  • 너울님께
    No Profile
    글쓴이 곽재식 19.02.01 22:55 댓글

    고백하자면 2월은 다가오는데 도대체 어찌 결말을 낼지 떠오르지 않아 비상수단으로 쓰는 어떤 수법을 써서 끝낸 이야기였습니다.

  • No Profile
    이지훈 19.02.03 11:15 댓글

    주인공을 보고 인간님이라고 하는 부분에서 과연 한국이 배경이구나 하는 것이 확 느껴집니다.

  • 이지훈님께
    No Profile
    글쓴이 곽재식 19.02.06 13:15 댓글

    한국 배경이 될 수 밖에 없는 뒷이야기를 조금 더 구체적으로 만들어 끼워 넣었으면 더 재밌게 할 수 있었을까 하는 생각도 좀 해 보게 됩니다.

  • No Profile
    지구여행자 19.02.03 20:01 댓글

    혼자인 주인공이 사회관계보다 혼자 지적 활동을 하는 것을 좋아하는 지적인 성향을 가지고 태어나서 똑똑한 엘리트처럼 성장하고, 낙관적인 결말을 맞아서 안도했네요. 주인공과 전혀 반대인 기질과 성격을 가진 아이였다면 굉장히 슬프고 비극적인 이야기가 되었을 것 같아요.

  • 지구여행자님께
    No Profile
    글쓴이 곽재식 19.02.06 13:13 댓글

    아마도 주인공을 양육하면서 그렇게 잘 버틸 성격으로 커나가도록 로봇들이 신경을 많이 썼을 것 같습니다.

분류 제목 날짜
아이 피에타 2019.04.01
해외 단편 우주 일화 — 레슬리 페리 2019.04.01
해도연 가시 위의 장미 2019.04.01
너울 [르포] ‘홀로그램 통화’ 6개월... 시민들 생활 어떻게 바뀌었나 2019.04.01
엄길윤 광고 2019.04.01
윤여경 라스트 아담1 2019.04.01
윤여경 리텔링 춘향 - 기괴한 시대의 기괴한 사랑 - 2019.04.01
amrita 특급! 82저승택배82 남바완 2019.03.31
곽재식 치카우 2019.03.31
해망재 권력의 기억1 2019.03.01
pilza2 던전에서 - 어둠 속을 나아가는 고통의 소설4 2019.03.01
너울 저 길고양이들과 함께6 2019.03.01
해도연 에일-르의 마지막 손님4 2019.03.01
amrita 초간단 오븐마법 레시피: #1032 2019.03.01
곽재식 이상한 하늘 강아지 이야기2 2019.02.28
곽재식 지상 최후의 사람일까요8 2019.02.01
해망재 은하레일의 밤 2019.02.01
annwn 빈티지의 맛 2019.02.01
지현상 우리 교실엔 악마가 있다3 2019.02.01
dcdc 블러디 발렌타인 크로니클1 2019.02.01
Prev 1 2 3 4 5 6 7 8 9 10 ... 39 Next

게시물의 무단 전재, 복사, 배포를 금합니다.

서버에 요청 중입니다. 잠시만 기다려 주십시오...